Recent studies on the development of practical diets for shrimp production systems using a novel microbial enhanced protein, ME-PRO®, have shown to be a promising solution to produce eco-friendly aquafeeds. The protein is processed at a state-of-the-art plant using non-GMO (non-genetically modified) soybean meal and a natural occurring, non-toxigenic, fungi, Aureobasidium pullulans . The fermented co-product also offers significant amounts of short-chain peptides and free amino acids that confer excellent attractability and palatability properties.
The objective of this study was to evaluate the inhibitory capacity of ME-PRO® at different concentrations (0.5%, 1% and 2%) against Vibrios spp. extracted from the midgut of Pacific white shrimp Penaeus vannamei . Shrimp post larvae (0.1 g) were weighed, macerated, and dissolved in 200ul sterile distilled water. A 50 uL sample was inoculated in TCBS agar and ChromAgar . All Vibrio and probiotic bacteria were resuspended in TSB medium. A 50 ul sample was inoculated in TSA agar plates in the case of probiotics and on ChromAgar for the Vibrio species. The results of bacterial growth count in agar were expressed in CFU/g for larvae. In addition, PCR analysis was conducted using the AP4 method with three sequences: F1 (ATGAGTAACAATATAAAACATGAAAC), R1 (ACGATTTCGACGTTCCCCAA) and F2 (TTG AGAATACGGGACGTGGG).
Results showed that inhibitory capacity of ME-PRO® was present at inclusion levels of 0.5%, 1% and 2% against Vibrio bacteria in macerates of shrimp larvae and inclusion in culture media ChromAgar Vibrio and TCBS. When the microbial enhanced protein was incorporated in TCBS and ChromAgar culture media, results indicated inhibitory activity for Vibrio type 1 (yellow colonies) between 38%, 48% and 57% respectively. For type 2 Vibrio , the inhibition rate was 78% and 100% for the 1 and 2% doses and for V. parahaemolyticus , 38%, 45% and 62% respectively. The evaluation of shrimp larvae macerates using TCBS agar indicated an inhibitory activity of Vibrios in the presence of the protein. Similarly, in ChromAgar a reduction in V. parahaemolyticus occurred when the 0.5% dose was used.
The assessment in this study indicated that an inclusion level as low as 1% ME-PRO® improves resistance to V. vulnificus and V. parahaemolyticus associated with high mortalities in shrimp aquaculture. Similar to previous studies, the results confirmed that supplementation into the diet of P. vannamei will confer a protective effect against the Vibrio species associated with Early Mortality syndrome (EMS).