World Aquaculture Society Meetings

SIMULTANEOUS DETECTION OF WHITE SPOT SYNDROME VIRUS (WSSV) AND PATHOGENIC VIBRIOS USING DUPLEX POLYMERASE CHAIN REACTION (PCR)

Mary Paz N. Aguana*, Carlo C. Lazado, Christopher M.A. Caipang
 
Institute of Aquaculture, College of Fisheries and Ocean Sciences
University of the Philippines Visayas, Miag-ao 5023, Iloilo, Philippines
marypaz_aguana@yahoo.com
 

Viral and bacterial pathogens are the major causes of shrimp diseases. Among these pathogens, luminous Vibrios and the white spot syndrome virus (WSSV) have led to serious economic damage due to massive mortality of the cultured stock. Using previously standardized PCR assays for the detection of pathogenic Vibrio spp. and WSSV in shrimp, the present study tested whether these protocols could be applied using field isolates from shrimp aquaculture in the Philippines. In addition, a duplex PCR using the above-mentioned primer sets for the simultaneous detection of both pathogens was also optimized.

Shrimp farms located in three different areas in Central Philippines were visited for the collection of samples for pathogen detection. Bacterial isolates that cause both luminous and non-luminous vibriosis were obtained from the pond water and hepatopancreas of moribund shrimp. Bacterial genomic DNA was extracted from pure bacterial cultures and the DNA samples were dissolved in 1x TE buffer and stored at -20oC until use for the PCR assays.

PCR primer set (forward: 5'- TGACTGGGTAGTCGCTGCTT - 3' and reverse: 5'-TATGAAGCCCGGACTTTCCT -3') for the detection of the ribonuclease P (RNase P) gene of the pathogenic Vibrio spp. and the primer set (forward: 5'- ACCTCTTTACTCCCT CGACT-3'; reverse: 5'- TTGTAGAGGGCATGAGGGAT-3') for the detection of WSSV were used. PCR amplification was carried out using the following conditions: initial denaturation at 95oC for 3 min, followed by 40 cycles of denaturation at 95oC for 30 s, annealing at 55oC for 30 sec and elongation at 72oC for 1 min; then a final elongation at 72oC for 5 min. Simultaneous detection of the pathogenic Vibrio spp. and WSSV in infected shrimp was carried out using duplex PCR.

The PCR primers targeting the ribonuclease P (RNase P) gene of Vibrio spp. were successful in amplifying the gene in all Vibrio isolates with the highest percentage of detection in the luminous colonies (80%) and lowest in the non-luminous and yellow-forming colonies (48%). Direct colony PCR of 30 bacterial isolates showed amplification of the RNP gene of Vibrio harveyi, regardless of the phenotypic characters. Detection of WSSV from fifteen (15) apparently healthy shrimps and 20 infected shrimps based on the presence of white spots on the carapace showed that almost all tissues of apparently healthy shrimps yielded negative results for WSSV except for an amplification of the viral gene in the gills (one shrimp) and pleiopods (two shrimps). WSSV, on the other hand, was detected in the pleiopods of 19 out of 20 infected shrimps. The virus was detected in the other tissues at a range of 75-90% rate of detection.

Standard PCR methods for the detection of pathogenic Vibrio spp. and WSSV were successfully utilized in field isolates for disease diagnostics in shrimp aquaculture in the Philippines. A duplex PCR method for simultaneous detection of both pathogens was optimized.

Copyright © 2001-2018 World Aquaculture Society All Rights Reserved.